avatar

JonathanT

Last updated: Jun 06, 2020

BW25113 - BC383

This is the barcoded version of BW25113 using lambda-red as barcoding method (Datsenko, KA and Wanner, BL). The DNA cassette was obtained from the attached plasmid. 

Draft
Barcode
v1 8328b5

8328b553bfd349f098d19ce9d95e05d6b2c0ad6eb

v1 GTCGTG

GTCGTGTCTGTCAATATCGGGGATAATAAATGTAGATAATGATTTCGTCAAGTCCTTACCCCGACTATACAACAGCAATCCATAGTAATCTGTGCGAATGGTTTAGTAGGACATAACACAAAT

Whole genome sequence
Strain data

Escherichia coli

ATCC 11775

BW25113 - BC

lacI+ rrnBT14 ΔlacZWJ16 hsdR514 ΔaraBADAH33 ΔrhaBADLD78
BC383

Devonshire Building. ICOS -80 room. Freezer 2. Box 1.

May 15, 2019