avatar

JonathanT

Last updated: Nov 20, 2020

W3110 ΔlacI

Constitutive gene expression in E. coli W3110 with a deleted lacI gene controlled by the tac promoter in the absence of an inducer 

Draft
Barcode
v1 7f2667

7f26676fcc424b478edc28312f3f4d6ab2c1e8a1e

v1 CCTTTT

CCTTTTGGTGCCGCCCCTAACACGACTACTCTGTAGTAATCGTCACCTGTCATACTTTTGTCTGTCGTGTATTAGCACGTGTTTTCACATCGGGAATCGTAGCTAGACACAGTCTGAGGC

Whole genome sequence

This study

#
Strain data

Escherichia coli

ATCC 11775

HM1

W3110

F-lambda-rph- INV (rrnD, rrnE)  ΔlacI

[-80 num 1]