avatar

JonathanT

Last updated: Aug 04, 2021

BW25113 - BC383

This is the barcoded version of BW25113 using CRISPR as barcoding method (Li et al. 2015). The attached plasmid contains the gRNA and the repair template.

Commited
Barcode
v1 8328b5

8328b553bfd349f098d19ce9d95e05d6b2c0ad6eb

v1 GTCGTG

GTCGTGTCTGTCAATATCGGGGATAATAAATGTAGATAATGATTTCGTCAAGTCCTTACCCCGACTATACAACAGCAATCCATAGTAATCTGTGCGAATGGTTTAGTAGGACATAACACAAAT

Whole genome sequence

This strain was produced in this study using the procedure described in: Li Y, Lin Z, Huang C, et al. Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Metab Eng. 2015;31:13‐21. doi:10.1016/j.ymben.2015.06.006

#
Strain data

Escherichia coli

ATCC 11775

s316

from parent

rrnB3 ΔlacZ4787 hsdR514 Δ(araBAD)567 Δ(rhaBAD)568 rph-1. BC383 (in between pyrH and frr)

Devonshire Building, Newcastle University. ICOS -80 room.

Apr 16, 2019