avatar

JonathanT

Last updated: Aug 05, 2021

168 - BC659

This is the barcoded version of 168 using CRISPR as barcoding method (J. Altenbuchner 2016). pBS-CRISPR2-BC was used to barcode this strain.

Commited
Barcode
v1 dcabd7

dcabd7cccc09420682210d4384131e65b2c2242df

v1 CTTACT

CTTACTATGCCACATAGTCTAACTACTTTGCGTAGGTAATAGAGCAACGAGTAGGGTTATCGTCTTTCATACTCGGTTGGCGATTATACAAACTCCAATGGTTTGATTGGTGTTTCTCATACG

Whole genome sequence

This strain was produced in this study using the procedure described in: J. Altenbuchner, “Editing of the Bacillus subtilis Genome by the CRISPR-Cas9 System.,” Appl. Environ. Microbiol., vol. 82, no. 17, pp. 5421–7, Sep. 2016, doi: 10.1128/AEM.01453-16.

#
Strain data

Bacillus subtilis

ATCC 6051

s356

from parent

trpC2, BC659 (in between rpsD and tyrS genes)

Trp(-)

Newcastle University, Devonshire Building. ICOS -80 room.

Nov 05, 2019