avatar

JonathanT

Last updated: Sep 01, 2021

EM383 - BC6

This is the barcoded version of EM383 using CRISPR/targetron as barcoding method (Velazquez et al, 2019). 

Commited
Barcode
v1 d763e1

d763e1bb2d3d4feea8ae15666c21476cb2c0bdf20

v1 CAGAGT

CAGAGTGCCGATATAGACCCAAATGGTCTTTACCTTTCAACGACAATAATGTGCGAACGCTATCTCAACGCCAACACTATTGGCGTTAGTCGGTTGCCATAGTTAGTAGCACAGCACATTAGC

This strain was produced by collaborators using the procedure described in: E. Velázquez, V. de Lorenzo, and Y. Al-Ramahi, “Recombination-Independent Genome Editing through CRISPR/Cas9-Enhanced TargeTron Delivery,” ACS Synth. Biol., vol. 8, no. 9, pp. 2186–2193, Sep. 2019, doi: 10.1021/acssynbio.9b00293.

#
Strain data

Pseudomonas putida

ATCC 12633

s369

Obtained from collaborators (see parent)

Δprophage1 Δprophage4 Δprophage3 Δprophage2 ΔTn7 ΔendA-1 ΔendA-2 ΔhsdRMS Δflagellum ΔTn4652 ΔrecA. BC6 (upstream of glmS gene)

Newcastle University, Devonshire Building. ICOS -80 room.

Nov 25, 2019