avatar

JonathanT

Last updated: Sep 01, 2021

J1074 - BC4

This is the barcoded version of J1074 using CRISPR as barcoding method (Cobb et al, 2015). The barcoding plasmid used was pSA-CRISPR-BC (attached).

Commited
Barcode
v1 4628c4

4628c45bf2094db399072ea78e24d055b2c8ef402

v1 GTTCGG

GTTCGGTCTGTCTTACTGCTCCCATTTTCTCGTCAATAATGTCCATACCAACGAGTAAAGGGTATATGAAAGGAGTGGATTTCACATCGTATCTCCCCATAGACTTTCACATTTGTTGTAGTG

Whole genome sequence

This strain was produced in this study using the procedure described in: Cobb RE, Wang Y, Zhao H. High-efficiency multiplex genome editing of Streptomyces species using an engineered CRISPR/Cas system. ACS Synth Biol. 2015;4(6):723-728. doi:10.1021/sb500351f

#
Strain data

Streptomyces albidoflavus

ATCC 25422

s268

from parent

BC4 (inserted in between XNR_3871 and XNR_3872)

Newcastle University, Devonshire Building. ICOS -80 room.

Feb 05, 2019