avatar

JonathanT

Last updated: Sep 01, 2021

BY4742 - KanMX - BC2

This is the barcoded version of BY4742 using Cre-Lox as barcoding method. The DNA cassette was PCR amplified from pSC-CreLox-BC (attached). 

Commited
Barcode
v1 b71000

b7100052fa292aa582de1f357f80a924b2ca667d1

v1 AATGCT

AATGCTTATCGTGTAGTAGGGTAGTTTGGATAGCGAGTTGAACAAGGGGTCGGTCATACAGACTTTGTGGGGAGTAAAGTCAGCGAAAGGGGTCTGTCGTCTTTAGAAGCGAACCATAGTGGC

Whole genome sequence

Fang F, Salmon K, Shen MW, et al. A vector set for systematic metabolic engineering in Saccharomyces cerevisiae. Yeast. 2011;28(2):123-136. doi:10.1002/yea.1824

#
Strain data

Saccharomyces cerevisiae

DSMZ DSM-70449

s349

from parent

S288C-derivative laboratory strain: MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0. KanMX-BC2 (inserted between NCA3 and ASF1)

Auxotrophic for: histidine, leucine, lysine and uracil. Kanamycin (G418) resistant

Devonshire Building, Newcastle University. ICOS -80 room.

Jun 20, 2019