avatar

JonathanT

Last updated: Jun 18, 2020

168 strain expressing GFP inserted at amyE locus. Barcoded.

GFP was inserted at amyE locus using the protocol and plasmid (attached) described in Veening et al. Barcode 207 updated previous barcode and identifies this strain (in between ybxH and ybxI)

Draft
Barcode
v1 9f57d6

9f57d680-018a-4422-9906-c17d6335bf04

v1 CACAAT

CACAATCCTACCCTAAAGGTAATGGTTTCAACACTATAATCGCAAGAGTTCCAATGTGGTCTATATAGATGTTCAATAGTCCTAATCGTGCTACACGCATAGACTAACAGACATACCCAACTC

Whole genome sequence

Jan-Willem Veening, Heath Murray and Jeff Errington. A mechanism for cell cycle regulation of sporulation initiation in Bacillus subtilis. Genes Dev. 2009, 23.

#

#
Strain data

Bacillus subtilis

ATCC 6051

168 - amyE GFP-cat (BC207)

trpC2, amyE::GFP-cat, BC207-zeoR

Trp(-), Chloramphenicol resistant, Zeocin resistant

Devonshire Building. ICOS -80 room. Freezer 2. Box 2.

Jun 06, 2019