JonathanT
This is the barcoded version of BW25113 using lambda-red as barcoding method (Datsenko, KA and Wanner, BL). The DNA cassette was obtained from the attached plasmid.
Draft8328b553bfd349f098d19ce9d95e05d6b2c0ad6eb
GTCGTGTCTGTCAATATCGGGGATAATAAATGTAGATAATGATTTCGTCAAGTCCTTACCCCGACTATACAACAGCAATCCATAGTAATCTGTGCGAATGGTTTAGTAGGACATAACACAAAT
Show GC content diagram
Escherichia coli
ATCC 11775BW25113 - BC
lacI+ rrnBT14 ΔlacZWJ16 hsdR514 ΔaraBADAH33 ΔrhaBADLD78
BC383
Devonshire Building. ICOS -80 room. Freezer 2. Box 1.
May 15, 2019
Genosignature™
Checksum
Genosignature™ and Checksum verification has FAILED
Genosignature™ verification SUCCESSFUL
Checksum verification FAILED
Genosignature™ verification FAILED
Checksum verification SUCCESSFUL
Icons made by
at
https://www.flaticon.com/Illustrations by
These Terms of Service (“Terms“) govern your use of the free services, software and websites (the “Service”) provided by CellRepo (“CellRepo”). Our Privacy Policy explains the way we collect and use your information. Our Acceptable Use Policy outlines our expectations with respect to your behaviour when using the Service. By using the Service you agree to be bound by these Terms, our Privacy Policy and our Acceptable Use Policy. If you’re using our Service on behalf of an organization or entity (“Organization”), then you are agreeing to these Terms on behalf of that Organization and you represent and warrant that you have the authority to bind the Organization to these Terms. In that case, “you” and “your” refers to that Organization.
The Service allows you to create project lines and associate to them information, text, files of various formats (e.g. in Microsoft Word, Microsoft Excel, Microsoft PowerPoint, Keynote, Adobe Illustrator, etc.), images, and other materials (together the “Content”) and to share that Content with others. You retain ownership of your Content, but by uploading it onto the Service, you are granting us a license to use, copy, reproduce, process, adapt, publish, transmit, host and display that Content for the purpose of (i) providing you the Service and associated support; and (ii) analysing and improving the operation of the Service. We reserve the right to remove Content on the Service that violates our Acceptable Use Policy or these Terms or that we otherwise reasonably believe may create liability for CellRepo. We do not scan or sell your content for marketing purposes.
You must provide accurate information when you create your CellRepo account. You are responsible for safeguarding the password and for all activities that occur under your account. You should notify CellRepo immediately if you become aware of any breach of security or unauthorized use of your account. You must comply with our Acceptable Use Policy at all times when using the Service. You may never use another user’s account without permission. You may not disassemble, decompile or reverse engineer the Service or attempt or assist anyone else to do so, unless such restriction is prohibited by law.Our Service is not intended for use by persons under the age of 16. By using the Service you are representing to us that you are over the age of 16.
When you sign up for our Service, you associate an email addresses with your account. If you use an email address provided to you by a third party entity of which you are a part (such as yourname@youremployer.com or yourname@nonprofit.org) (each an “Entity”) you hereby grant that Entity and its administrator(s) permission to access, use, download, export, disclose, share, restrict and/or remove Content that you have associated with the email address that includes their domain. You acknowledge and understand that an Entity may elect to utilize one or more third party applications in connection with their teams’ use of the Service and that, by associating Content with an email address that includes an Entity’s domain, you are granting permission to have such Content shared with such third party application(s). You also acknowledge and understand that an Entity may restrict or terminate your access to Content associated with the email address that includes their domain. Please remember that you can associate a different email address with your CellRepo account, so you may want to consider associating personal Content with a personal email address.
We will use industry standard technical and organizational security measures in connection with the storage, processing and transfer of your Content that are designed to protect the integrity of that Content and to guard against unauthorized or unlawful access to, use of, or processing of such Content.
You are free to stop using our Service at any time. We also reserve the right to suspend or end the Service at any time at our discretion and without notice. We may also terminate or suspend your access to the Service at any time if you are not complying with these Terms or our Acceptable Use Policy or if you are using the Service in a manner that we believe may cause us financial or legal liability.
The Service (excluding Content provided by users) constitutes CellRepo’s intellectual property and will remain the exclusive property of CellRepo and its licensors. Any feedback, comments, or suggestions you may provide regarding the Service is entirely voluntary and we will be free to use such feedback, comments or suggestions as we see fit and without any obligation to you.
CellRepo respects the intellectual property rights of others and we expect our users to do the same. We respond to notices of alleged copyright infringement if they comply with the law, and such notices should be reported to us.
The Service may be modified from time to time, often without prior notice to you. Your continued use of the Service constitutes your acceptance of such modifications. If you are not satisfied with a modification we make to the Service, your sole remedy is to terminate your use of the Service.
You agree to defend, indemnify and hold harmless CellRepo and its licensee and licensors, and their employees, contractors, agents, officers and directors, from and against any and all claims, damages, obligations, losses, liabilities, costs or debt, and expenses (including but not limited to attorney’s fees) arising from your use of and access to the Service or the Software, or from or in connection with any Content uploaded to the Service through your account by you or a third party using your account with your knowledge or consent.
The service is currently a "beta" product, i.e., it is not a finished product. THE SERVICE IS PROVIDED ON AN “AS IS” AND “AS AVAILABLE” BASIS WITHOUT ANY WARRANTY OF ANY KIND, WHETHER EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO IMPLIED WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, OR NON-INFRINGEMENT. CELLREPO IS NOT RESPONSIBLE FOR ANY THIRD PARTY CONTENT THAT YOU UPLOAD, DOWNLOAD OR OTHERWISE OBTAIN THROUGH THE USE OF THE SERVICE OR FOR ANY DAMAGE OR LOSS OF DATA THAT MAY RESULT. WE DO NOT WARRANT, ENDORSE, GUARANTEE, OR ASSUME RESPONSIBILITY FOR ANY THIRD PARTY APPLICATION OR SERVICE THAT PROVIDES ACCESS TO OUR SERVICE. The Service is controlled and operated within the U.K. Parts of The Service is hosted in Europe, the USA and elsewhere. We make no representations that the Service is appropriate or available for use in locations other than the UK. Those who access or use the Service from other jurisdictions do so at their own risk and are responsible for compliance with all applicable UK and local laws and regulations, including but not limited to export and import regulations.
TO THE MAXIMUM EXTENT PERMITTED BY LAW, IN NO EVENT SHALL CELLREPO, ITS AFFILIATES, AGENTS, DIRECTORS, EMPLOYEES OR SUPPLIERS BE LIABLE FOR ANY DIRECT, INDIRECT, PUNITIVE, INCIDENTAL, SPECIAL, CONSEQUENTIAL OR EXEMPLARY DAMAGES, INCLUDING WITHOUT LIMITATION DAMAGES FOR LOSS OF PROFITS, GOODWILL, DATA OR OTHER INTANGIBLE LOSSES THAT RESULT FROM THE USE OF, OR INABILITY TO USE, THE SERVICE, WHETHER OR NOT CELLREPO HAS BEEN WARNED OF THE POSSIBILITY OF SUCH DAMAGES AND EVEN IF A REMEDY FAILS OF ITS ESSENTIAL PURPOSE. CELLREPO’S AGGREGATE LIABILITY FOR ALL CLAIMS RELATED TO THE SERVICE SHALL NOT EXCEED £100.
You agree that prior to filing any claim against CellRepo relating to or arising out of these Terms you will first contact us at natalio.krasnogor@newcastle.ac.uk to provide us with an effort to resolve the issue in an informal manner. No Collective Actions - ALL CLAIMS MUST BE BROUGHT ON AN INDIVIDUAL BASIS AND NOT AS A PLAINTIFF OR COLLECTIVE ACTION MEMBER.
The laws of the United Kingdom (UK) of Great Britain and Northern Ireland will govern these Terms. The application of the United Nations Convention on Contracts for the International Sale of Goods is expressly excluded.
In connection with providing you the Service CellRepo may transfer, store and process your Content in the UK or in any other country in which CellRepo, its agents maintain or hire facilities or by hosting subcontractors. By using the Service you consent to this transfer, processing and storage of your Content.
These Terms constitute the entire agreement between you and CellRepo concerning the Service, replace any prior or contemporaneous agreements, terms or conditions applicable to your use of the Service. If a provision of these Terms is found to be unenforceable, the remaining provisions of these Terms will remain in full force and effect and an enforceable term will be substituted reflecting as closely as possible our original intent. CellRepo’s failure to enforce any provision of these Terms shall not be deemed a waiver of its right to do so later.
These Terms and any rights and licenses granted hereunder, may not be transferred or assigned by you, but may be assigned by us without restriction. Any attempted transfer or assignment by you will be null and void.
We may provide you with legal notices and notices related to your account via email using the email address associated with your account. We may provide you with other marketing or business-related information, including information about Service updates or changes, via email or via our blog. For questions about these or any CellRepo terms or policies, email us at natalio.krasnogor@newcastle.ac.uk
This Privacy Policy describes CellRepo’s practices regarding the collection, use and disclosure of the information we collect from and about you when you use CellRepo’s web-based application (the “Service”). We take our obligations regarding your privacy seriously and have made every effort to draft this Privacy Policy in a manner that is clear and easy for you to understand. By accessing or using the Service, you agree to this Privacy Policy
We use industry standards to store and transfer your data between our subsystems and our subcontractors. We do not scan or sell to third parties your content, not for marketing and not for any other purpose. The personal data we collect about you is the bare minimum we require to be able to provide you with the service and we do so under the legal basis called "Legitimate Interest". We only collect your email address, name, photo, IP address from where you access CellRepo, browser and email client used (e.g. Safari, Firefox, Internet Explorer, etc), geo-location and such information that allows us to improve, debug and customise our service for you. We utilise cookies to refine your experience. You can block cookies in your browser at any time. We utilise world-leading, cloud service providers to run our service (e.g. Amazon Web Services Cloud provider, Heroku, SendGrid). This means that your content and personal data might transit between our systems and theirs for the sole purpose of delivering CellRepo functionality to you. These providers are also under the purview of the GDPR legislation. At any time, you have the right to cancel your account and delete all the data we hold of you. For queries regarding our privacy policy please email us to natalio.krasnogor@newcastle.ac.uk
The lawful basis upon which we collect your personal information is "Legitimate Interest". We collect the minimal amount of personal information that we need as to be able to deliver our service. We collect personal information, such as your name, email address when you register for an account on the Service. You may also provide us with optional information such as a photograph. Your user name, email address and any optional profile information that you elect to associate with your account is referred to herein as your “Profile Information”. We may use your email address to send you Service-related notices (including any notices required by law, in lieu of communication by postal mail). We may also use your email address to send you announcements and information about other products or services (including third party services) that you may be interested in (together, the “Marketing Messages”). We do not sell your e-mail address to third parties.
Your use of the Service will involve you uploading or inputting various content into the Service. CellRepo may view your Content only as necessary (i) to maintain, provide and improve the Service; (ii) to resolve a support request from you; (iii) if we have a good faith belief, or have received a complaint alleging, that such Content is in violation of our Acceptable Use Guidelines; (iv) as reasonably necessary to allow CellRepo to comply with or avoid the violation of applicable law or regulation; or (v) to comply with a valid legal request. We may also analyse the Content in aggregate and on an anonymized basis, in order to better understand the manner in which our Service is being used. We do not scan content and we do not sell it to third parties.
You have a right to delete your account and its associated data (together, "terminate"). Do this on your user page
When you use the Service, our servers automatically record certain information in server logs. These server logs may include information such as your web request, Internet Protocol (“IP”) address, browser type and settings, referring / exit pages and URLs, number of clicks and how you interact with links on the Service, domain names, landing pages, pages viewed, mobile carrier, date and time stamp information, geo-location data and other such information. Log files help us to monitor, analyse, improve and maintain the Service and to diagnose and fix any Service-related issues.
When you access the Service using a mobile device, we collect specific device information contained in your mobile device’s “device identifier.” This device identifier includes information such as the type of device you are using, its operating system, and mobile network information, which may include your mobile phone number. We may associate this device identifier with your Service account and will use data associated with your device identifier to customize our Services to your device and to analyse any device-related issues.
We collect and process information about the location of the device from which you are accessing the Service. Location data may convey information about how you browse the Service and may be used in conjunction with personally identifiable information.
CellRepo uses technologies like cookies, pixel tags and web beacons to provide, monitor, analyse, promote and improve the Service. For example, a cookie is used to remember your timezone when you return to the Service and to improve our understanding of how you interact with the Service. You can block cookies on your web browser; however please be aware that some features of the Service may not function properly if the ability to accept cookies is disabled. You may disable or block cookies by adjusting your browser preferences at any time; however, please be aware that some features of the Service may not function properly if the ability to accept cookies is disabled. We may utilize third-party service providers to provide us with analytics services and to serve advertisements on our behalf across the Internet. These parties may utilize cookies or similar technologies to gather information about your browsing activities over time and across different websites following your use of the Service
We may share the information we collect from you with third parties as detailed below. We will display your Profile information on your profile page and elsewhere on the Service. You can review and revise your Profile information at any time. We will display your Content within the Service as directed by you. If you elect to use a third party application to access the Service, then we may share or disclose your account and Profile information and your Content with that third party application as directed by you. Please remember that we are not responsible for the privacy practices of such third parties so you should make sure you trust the application and that it has a privacy policy acceptable to you. We may utilize trusted third party service providers to assist us in delivering, improving, protecting and promoting our Service. For example, we may use third parties to help host our Service, send out email updates, perform analyses related to the operation of our Service, or process payments. We may also store personal information in locations outside the direct control of CellRepo (for instance, on servers or databases co-located with hosting providers). These service providers may have access to your information for the limited purpose of providing the service we have contracted with them to provide. They are required to have a privacy policy and security standards in place that are at least as protective of your information as is this Privacy Policy. Currently, our service relies on the following third party providers: Amazon Web Services Cloud, Sendgrid, Heroku. We may disclose your information (including your personally identifiable information) in response to a lawful request by public authorities, including to meet national security or law enforcement requirements. We may also disclose your information to our legal counsel, governmental authorities or law enforcement if we believe that it is reasonably necessary to do so in order to comply with a law or regulation; to protect the safety of any person; to address fraud, security or technical issues; or to protect CellRepo’s rights or property. We may disclose aggregate non-personally identifiable information (such as aggregate and anonymous usage data, platform types, etc.) about the overall use of our Service publicly or with interested third parties to help them understand, or to help us improve, the Service. If the ownership of all or substantially all of our business changes, we may transfer your information to the new owner so that the Service can continue to operate. In such case, your information would remain subject to the promises and commitments contained in this Privacy Policy until such time as this Privacy Policy is updated or amended by the acquiring party upon notice to you.
The security of your information is important to us. CellRepo uses commercially reasonable and industry-standard physical, managerial, and technical safeguards to preserve the integrity and security of your information. If you have any questions about security on our Service, contact us at natalio.krasnogor@newcastle.ac.uk. Although we allow you control over your Content and what information is included in your Profile and take reasonable steps to maintain the security of the information associated with your account, please be aware that no security measures are perfect or impenetrable. We cannot control the actions of other users with whom you share your Content and we are not responsible for third party circumvention of any privacy settings or security measures on the Service. You may, of course, decline to submit personally identifiable information through the Service, in which case CellRepo may not be able to provide certain services to you. You have a right to access information we hold about you. You may update or correct your account information at any time by logging in to your account. For questions or inquiries regarding the correction or deletion of your personally identifiable information on the Service you may contact us at natalio.krasnogor@newcastle.ac.uk
Our Service is not directed to persons under 16. CellRepo does not knowingly collect or solicit personal information from anyone under the age of 16 or knowingly allow such persons to register for an account on the Service. If we become aware that we have collected personal information from a child under age 16 without verification of parental consent, we take steps to remove that information. If you believe that we might have any information from or about a child under 16, please contact us at natalio.krasnogor@newcastle.ac.uk
We may transfer information that we collect about you, including personally identifiable information, to affiliated entities, or to other third parties (as provided herein) across borders and from your country or jurisdiction to other countries or jurisdictions around the world. If you are located in the European Union or other regions with laws governing data collection and use that may differ from UK law, please note that you are transferring information, including personal information, to a country and jurisdiction that does not have the same data protection laws as your jurisdiction, and you consent to the transfer of information to the UK and other locations where our hosting servers operate and the use and disclosure of information about you, including personal information, as described in this Privacy Policy.
We are not responsible for the practices employed by websites linked to from within the Service, nor the information or content contained therein. Please remember that when you use a link to go from the Service to another website, our Privacy Policy is no longer in effect and your activities on that third party website is subject to such third party website’s own rules and policies.
Some browsers have a “do not track” feature that lets you tell websites that you do not want to have your online activities tracked. We currently do not respond to “do not track” signals.
If we change our Privacy Policy, we will post those changes on this page to keep you aware of what information we collect, how we use it and under what circumstances we may disclose it. Changes to this Privacy Policy are effective when they are posted on this page. For questions about our privacy policy email us at natalio.krasnogor@newcastle.ac.uk The lawful basis upon which we collect your personal information is "Legitimate Interest". We collect the minimal amount of personal information that we need as to be able to deliver our service. We collect personal information, such as your name, email address when you register for an account on the Service. You may also provide us with optional information such as a photograph. Your user name, email address and any optional profile information that you elect to associate with your account is referred to herein as your “Profile Information”. We may use your email address to send you Service-related notices. Even if you are not a registered user of our Service, if you email us we may retain a record of such email communication, including your email address, the content of your email, and our response. If you choose to use our invitation service to invite a friend to the Service, we will ask you for that person’s contact information, which may include their email address or their social network identity, and automatically send an invitation. CellRepo stores the information you provide to send the invitation, to register your friend if your invitation is accepted, and to track the success of our invitation service.
Disruption of the Service. You may not - Access, tamper with, or use non-public areas of the Service, CellRepo’s computer systems, or the technical delivery systems of CellRepo’s providers; Probe, scan, or test the vulnerability of any system or network or breach or circumvent any security or authentication measure; Access or search the Service by any means other than CellRepo’s publicly supported interfaces (for example, “scraping”); Attempt to disrupt or overwhelm our infrastructure by intentionally imposing unreasonable requests or burdens on our resources (e.g. using “bots” or other automated systems to send requests to our servers at a rate beyond what could be sent by a human user during the same period of time);
Interfere with or disrupt the access of any user, host or network, including, without limitation, by sending a virus, overloading, flooding, spamming, mail-bombing the Service, or by scripting the creation of Content in such a manner as to interfere with or create an undue burden on the Service.
Misuse of the Service. You may not utilize the Service to carry out, promote or support-
Any unlawful or fraudulent activities;
The impersonation of another person or entity or the misrepresentation of an affiliation with a person or entity in a manner that does or is intended to mislead, confuse, or deceive others;
Activities that are defamatory, libellous or threatening, constitute hate speech, harassment, or stalking;
The publishing or posting other people’s private or personally identifiable information, such as credit card numbers, street address, national insurance number or Social Security/National Identity numbers, without their express authorization and permission;
The sending unsolicited communications, promotions advertisements, or spam;
The publishing of or linking to malicious content intended to damage or disrupt another user’s browser or computer; or
Promotion or advertisement of products or services other than your own without appropriate authorization from us.
Content Standards Within the Service. You may not post any Content on the Service that-
Violates of any applicable law, any third party’s intellectual property rights, or anyone’s right of privacy or publicity;
Is deceptive, fraudulent, illegal, obscene, pornographic (including child pornography, which, upon becoming aware of, we will remove and report to law enforcement), defamatory, libellous or threatening, constitutes hate speech, harassment, or stalking;
Contains viruses, bots, worms, or similar harmful materials; or
Contains any information that you do not have a right to make available under law or any contractual or fiduciary duty.
Violations of this Acceptable Use Policy. In addition to any other remedies that may be available to us, CellRepo reserves the right to immediately suspend or terminate your account or your access to the Service upon notice and without liability for CellRepo should you fail to abide by this Acceptable Use Policy. If you are a user of the Service under your employer or organization’s account, CellRepo reserves the right to notify your employer or organization of any violations of this Acceptable Use Policy.
Modifications. CellRepo may amend or modify this Acceptable Use Policy from time to time in its sole and reasonable discretion. We will post any such changes on our website. If you object to any such change(s), your sole recourse shall be to cease using the Service. Continued use of the Service following notice of any such changes shall constitute your acknowledgement and acceptance of such changes. For questions about acceptable use or any CellRepo terms or policies, email us at natalio.krasnogor@newcastle.ac.uk
