avatar

JonathanT

Last updated: Sep 01, 2021

BY4742 - BC14

This is the barcoded version of BY4742 using CRISPR as barcoding method. The barcoding plasmid used was pSC-CRISPR-BC (attached). 

Commited
Barcode
v1 253409

253409d080d84428865bbd125364798ab2c64d5a8

v1 ATTGGG

ATTGGGGTGGTTCGTCAATGTGTAGAGCGTTGTGAGTAAGTTATTGAGTTCAACGGGGCAAATCTTTATATTGGGGATAACTAAAGTCAATGCGAACCATAGTTGAACTAACTTGGGGGAGAG

Whole genome sequence

Barcoding protocol based on: M. M. Jessop-Fabre et al., “EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9,” Biotechnol. J, vol. 11, pp. 1110–1117, 2016, doi: 10.1002/biot.201600147.

#
Strain data

Saccharomyces cerevisiae

DSMZ DSM-70449

s337

from parent

S288C-derivative laboratory strain: MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0. BC14 (inserted between NCA3 and ASF1)

Auxotrophic for: histidine, leucine, lysine and uracil. 

Newcastle University, Devonshire Building. ICOS -80 room.

May 09, 2019